View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20315_high_17 (Length: 275)
Name: NF20315_high_17
Description: NF20315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20315_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 2371373 - 2371118
Alignment:
| Q |
1 |
ttttgcgatttttgtgtttctgaatcggtttacgattttatggttcatcagtttggaattaaacatctctgccaacgggtaaaaatgtcgtaatgtcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2371373 |
ttttgcgatttttgtgtttctgaaccggtttacggttttatggtgcatcagtttggaattaaacatctctgccaacgggtaaaaatgtcataatgtcttc |
2371274 |
T |
|
| Q |
101 |
caaaagctccttaatataccggtaatagtggcggttaacaaaaacaccttaacaaaatcatcataattcacatgttttttatagtggttatccacaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2371273 |
caaaagctccttaatataccggtaatagtggcggttaacaaaaacaccttaacaaaatcatcataattcacatgttttttatagtggttatccacaacca |
2371174 |
T |
|
| Q |
201 |
aggcaacacattcctcttttggaactttatgaatattctttctatgaagtgagtaattg |
259 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2371173 |
aggcaacacattgctcttttggaactttatgaa---tctttctatgaagtgagtaattg |
2371118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 12128231 - 12128267
Alignment:
| Q |
184 |
gtggttatccacaaccaaggcaacacattcctctttt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12128231 |
gtggttatccacaaccaaggcaacacattactctttt |
12128267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University