View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20315_low_14 (Length: 351)
Name: NF20315_low_14
Description: NF20315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20315_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 35912767 - 35912509
Alignment:
| Q |
1 |
atcttcttgcaatagagtttcacacacaacaagattcaaaaggtttctctttagctagatgtattgtgtatttcactctttcacttactcattacttata |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35912767 |
atcttcttggaatagagtttcacacacaacaagattcaaaaggtttctctttagctagatgtattgtgtatttcactctttcacttactcattacttata |
35912668 |
T |
 |
| Q |
101 |
tagacttgttagtgctgtccttgagattgtaaagtttgtatttatcttcttgaat---attaaatagatgaaactatgttaaaattgacaaatattaaag |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35912667 |
tagacttgttagtgctgtccttgagattgtaaagtttgtatttatcttcttgaatattattaaatagatgaaactatgttaaaattgacaaatattaaag |
35912568 |
T |
 |
| Q |
198 |
aaaaataaaatatagttta------tgtttgtgtctcaattaaatatgttgtcgtgaac |
250 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35912567 |
aaaaataaaatatagtttatgtttgtgtttgtgtctcaattaaatatgttgtcgtgaac |
35912509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University