View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20315_low_24 (Length: 257)
Name: NF20315_low_24
Description: NF20315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20315_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 3 - 241
Target Start/End: Original strand, 20130950 - 20131188
Alignment:
| Q |
3 |
cagagattggaaagttgtcaaatcttttggtgtttttcgcttggcagaatcagcttgaaggaagcattccttcaagtttaggaaactgtagtaaacttca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20130950 |
cagagattggaaagttgtcaaatcttttggtgtttttcgcttggcagaatcagcttgaaggaagcattccttcaagtttaggaaactgtagtaaacttca |
20131049 |
T |
 |
| Q |
103 |
agcacttgatttgtctaaaaattcactcactggtagcattccttcaggactgtttcagcttcaaaacctcacaaaactgcttttgatttcaaatgatata |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20131050 |
agcacttgatttgtctagaaattcactcactggtagcattccttcaggactatttcagcttcaaaacctcacaaaactgcttttgatttcaaatgatata |
20131149 |
T |
 |
| Q |
203 |
tcaggttctataccatcagaaataggtagttgtaaatct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20131150 |
tcaggttctataccatcagaaataggtagttgcaaatct |
20131188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University