View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20315_low_26 (Length: 249)
Name: NF20315_low_26
Description: NF20315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20315_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 33275807 - 33275579
Alignment:
| Q |
1 |
aggtgaatgtgtgagtcacgtttagtgaaattgaagagaatgggaatggaaagtgggaacaaaagggaggcaagaggttgggcaaggtgagataaggaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33275807 |
aggtgaatgtgtgagtcacgtttagtgaaattgaagagaatgggaatggaaagtgggaacaaaagggaggcaagaggttgggcaaggtgagataaggaca |
33275708 |
T |
 |
| Q |
101 |
gtttccaccaatgaggtgagtgtgatgtgtaatgaacaagataggatagtatgagatttggggtttaattcgaagggataggtgttttttctattgagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||| |||||| ||| |
|
|
| T |
33275707 |
gtttccaccaatgaggtgagtgtgatgtgtaatgaacaagataggatagtaagagatttggggtttaa-----------cggtg-ttttcctattgtgtt |
33275620 |
T |
 |
| Q |
201 |
ccttcactctgcttcattaattgtgtcattagttttctgtg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33275619 |
ccttcactctgcttcattaattgtgtcatttgttttctgtg |
33275579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 149 - 238
Target Start/End: Complemental strand, 33274550 - 33274462
Alignment:
| Q |
149 |
gtatgagatttggggtttaattcgaagggataggtgttttttctattgagttccttcactctgcttcattaattgtgtcattagttttct |
238 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||| |||||||| || ||||||||| || |||||| ||||||||||| ||||||| |
|
|
| T |
33274550 |
gtattagatttggggtttaattcgaagggccaggtg-tttttctactgcattccttcaccatgattcattgattgtgtcatttgttttct |
33274462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University