View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20315_low_27 (Length: 249)
Name: NF20315_low_27
Description: NF20315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20315_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 2088367 - 2088142
Alignment:
| Q |
1 |
gtattttgatatgttcaaatagtattttcatctcttatttatataatcttgtatttttaatggtgaagccacttttctgttgtgtgcacatgtaatgacg |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2088367 |
gtattttgatattttcaaatagtattttcatctcttatttatata-tcttgtatttttaatggtgaagccacttttctgttgtgtgcacatgtaatgacg |
2088269 |
T |
 |
| Q |
101 |
ttgg--------attcaactagnnnnnnnnnnnnnntcatggttgaaatataaggttttcaacttaacatctttatatcttctctttgagagttatcgtg |
192 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| || |
|
|
| T |
2088268 |
ttggatttcaatattcaactag----atatatatattcatggttgaaatataaggttttcaacttcacatttttatatcttctctttgagagttatcttg |
2088173 |
T |
 |
| Q |
193 |
aagtattttataagcgtaatttttgtatact |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2088172 |
aagtattttataagcgtaatttttgtatact |
2088142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University