View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20315_low_33 (Length: 220)
Name: NF20315_low_33
Description: NF20315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20315_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 25138710 - 25138510
Alignment:
| Q |
1 |
aaagaacaaaatgtttatcttcaattccctttcttaaagtctgcgaaaggtgcaaatgtatgtggaaactttgtctcaatcctaaattgttgtcttttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25138710 |
aaagaacaaaatgtttatcttcaattccctttcttaaagtctgcgaaaggtgcaaatgtatgtggaaactttgtctcaatcctaaattgttgtcttttgt |
25138611 |
T |
 |
| Q |
101 |
agatgccaaaatataatagcatctttgaggggggcttcatctcttaattcccttttgtttaaaaacgagatgtttgaattgatgtgtattcgatgcctta |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25138610 |
agatgccaaa--ataatagcatctttgagaggggcttcatctcttaattcccttttgtttaaaaacgagatgtttgaattgatgtgtattcgatgcctta |
25138513 |
T |
 |
| Q |
201 |
tgt |
203 |
Q |
| |
|
||| |
|
|
| T |
25138512 |
tgt |
25138510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University