View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20315_low_35 (Length: 213)
Name: NF20315_low_35
Description: NF20315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20315_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 8264456 - 8264535
Alignment:
| Q |
18 |
gaaacatgttatggactttgtatactatattttacccgtatgatagtgttgaggggaaaattataatgttacaatttgattgtccatcggtt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8264456 |
gaaacatgttatggactttgtatactatattttact------------ttgaggggaaaattataatattacaatttgattgtccatcggtt |
8264535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 198
Target Start/End: Original strand, 8265701 - 8265746
Alignment:
| Q |
153 |
gggggtgatgtttatcaacatgttttcctttcaaattgaccttcat |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8265701 |
gggggtaatgtttatcaacatgttttcctttcaaattgaccttcat |
8265746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University