View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20315_low_36 (Length: 201)
Name: NF20315_low_36
Description: NF20315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20315_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 109 - 187
Target Start/End: Complemental strand, 36962348 - 36962271
Alignment:
| Q |
109 |
taaatttaataacttaataaacaactttcactagagataatttaagggattgaaattgaaacatcaccccttttgttat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36962348 |
taaatttaataacttaataaacaactttcactagagatgatttaagggattgaaattgaaacatca-cccttttgttat |
36962271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 36963169 - 36963070
Alignment:
| Q |
19 |
ggaactccctccatgtgagtcctaacaatttcaacataccgactagatgagctctaa-tnnnnnnnntgaaacaattgcttatttaccacataaatttaa |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
36963169 |
ggaactccctccatgtaagtcctaacaatttcaacatactgactagatgagctctaattaaaaaaaatgaaacaattgcttatttaccacataaatttaa |
36963070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University