View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20316_high_40 (Length: 222)
Name: NF20316_high_40
Description: NF20316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20316_high_40 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 4 - 222
Target Start/End: Original strand, 47625838 - 47626056
Alignment:
| Q |
4 |
caacaactaagggttagtttatttatatgatgtttctattaatccataattagcatctttgaccctagtaagcgcgccaaaatatctttatggcttagac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625838 |
caacaactaagggttagtttatttatatgatgattctattaatccataattagcatctttgaccctagtaagcgcgccaaaatatctttatggcttagac |
47625937 |
T |
 |
| Q |
104 |
tctttgagcctgccataagattaatcctcggatcgaacatccaaacttttttcacgtggaattgcgatacctatcaaatcggctattatagtaatctaat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625938 |
tctttgagcctgccataagattaatcctcggatcgaacatccaaacttttttctcgtggaattgcgatacctatcaaatcggctattatagtaatctaat |
47626037 |
T |
 |
| Q |
204 |
ttagtcatgctatcaattt |
222 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47626038 |
ttagtcatgctatcaattt |
47626056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University