View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20316_low_40 (Length: 265)
Name: NF20316_low_40
Description: NF20316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20316_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 247
Target Start/End: Original strand, 30416951 - 30417187
Alignment:
| Q |
11 |
cacagaagccagaatcagaacaaagaacagaatcatacacacatatgcagcactcagaaaacaaagacccagtttcttaagcaatactatgctaccataa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30416951 |
cacagaagccagaatcagaacaaagaacagaatcatacacacatatgcagcactcagaaaacaaagacccagtttcttaagcaatactatgctaccataa |
30417050 |
T |
|
| Q |
111 |
gctatttgtgaaggagcattgtctttggtttgcccatcatgatggtaggactcagatgtcactgtcagaagagagtagaaaggggaaaagacagaggcca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30417051 |
gctatttgtgaaggagcattgtctttggtttgcccatcatgatggtaggactcagatgtcactgtcagaagtgagtagaaaggggaaaagacagaggcca |
30417150 |
T |
|
| Q |
211 |
tgctgttgtagagtaagtctgctggtgtaggcaaaac |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30417151 |
tgctgttgtagagtaagtctgctggtgtaggcaaaac |
30417187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University