View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20316_low_48 (Length: 209)
Name: NF20316_low_48
Description: NF20316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20316_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 14 - 143
Target Start/End: Original strand, 1028274 - 1028403
Alignment:
| Q |
14 |
cagagataccaaatacgatcgatgttagcccttggaagcaaaagctcatggtcatctttgttctcatgagttcaacgattacttcatcagtgctggctcg |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1028274 |
cagagataccaaatacgatcgatgttggcccttggaagcaaaagctcatggtcatctttgttctcatgagttcaacgattacttcatcagtgctggctcg |
1028373 |
T |
|
| Q |
114 |
taaatacaaaagaaaattagttgacttttg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1028374 |
taaatacaaaagaaaattagttgacttttg |
1028403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 141 - 194
Target Start/End: Original strand, 1033609 - 1033662
Alignment:
| Q |
141 |
ttggtgattgctggcagttgctgcttccaaattctgcttcatttctatgggaag |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1033609 |
ttggtgattcctggcagttgctgcttccaaattctgcttcatttctgtgggaag |
1033662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 141 - 194
Target Start/End: Original strand, 4516149 - 4516202
Alignment:
| Q |
141 |
ttggtgattgctggcagttgctgcttccaaattctgcttcatttctatgggaag |
194 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4516149 |
ttggtgattcctggcagctgctgcttccaaattctgcttcatttctgtgggaag |
4516202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 194
Target Start/End: Complemental strand, 50832502 - 50832448
Alignment:
| Q |
143 |
ggtgattgctggcagttgctgcttccaaatt---ctgcttcatttctatgggaag |
194 |
Q |
| |
|
||||||| |||||||||||||||||| |||| ||||||||||||| ||||||| |
|
|
| T |
50832502 |
ggtgattcctggcagttgctgcttccgaattccgctgcttcatttctgtgggaag |
50832448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University