View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20317_high_2 (Length: 408)
Name: NF20317_high_2
Description: NF20317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20317_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 10 - 391
Target Start/End: Complemental strand, 43792202 - 43791821
Alignment:
| Q |
10 |
cagagaagagatttttgctcaaatccaatatcacttgtaactcatcaagccctcctagctcaattggtatagtacctgtcaagaaattttgtgagagcct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43792202 |
cagagaagagatttttgctcaaatccaatatcacttgtaactcatcaagccctcctagctcaattggtatagtacctgtcaagaaattttgtgagagcct |
43792103 |
T |
 |
| Q |
110 |
tagctcgtagagcttcttgcattgatgaattgttgaaggaattaagccggagagactattgctttgaatgttgaagacattaagagaaatgaggttccca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43792102 |
tagctcgtagagcttcttgcattgatgaattgttgaaggaattaagccggagagactattgctttgaatgttgaagacattaagagaaatgaggttccca |
43792003 |
T |
 |
| Q |
210 |
atctcttgaggaatttcaccagacaaattgttgtgatggagagaaagcttaagtaattttgagcagttaccaatttcagcaggtaccttgccactgaagt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43792002 |
atctcttgaggaatttcaccagacaaattgttgtgatggagagaaagcttaagtaaatttgagcagttaccaatttcagcaggtaccttgccactgaagt |
43791903 |
T |
 |
| Q |
310 |
tattgtatgagagatctaactcaccaagttgttggaaatctcccaaccacggaggtatttctccgctcaatctgttgttact |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43791902 |
tattgtatgagagatctaactcaccaagttgttggaaatctcccaaccacggaggtatttctccgctcaatctgttgttact |
43791821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University