View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20317_high_4 (Length: 316)
Name: NF20317_high_4
Description: NF20317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20317_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 15359257 - 15359564
Alignment:
| Q |
1 |
agatcgcgatttgcgcttttcttttcctttaggtgaagtatacgacacttccttcacttcaatcattgaaccagcattgatatcttgtgtctgttccatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
15359257 |
agatcgcgatttgcgcttttcttttcctttaggtgaagtagacgacacttccttcacttcaatctttgaaccaacatttatatcttgtgtctgtgccatg |
15359356 |
T |
 |
| Q |
101 |
actagaacatgagcttcttcttcttttaagaaaccaatgaatgaagctttagatatctccgagtaacttctttccatagtaactattttctcttcaatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15359357 |
actagaacatgagcttcttcttcttttaagaaaccaatgaatgaagctttagatatctccgagtaacttctttccatagtaactattttctcttcaatga |
15359456 |
T |
 |
| Q |
201 |
gaccatgctcatcatgagacattgagttgctgatatttagacttgccttgtttgacaagttatcatctgaagacttatcaagcaatggaatttgatccga |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15359457 |
gaccatactcatcatgagacattgagttgctgatatttagacttgccttgtttggcaagctatcatctgaagacttatcaagcaatggaatttgatccga |
15359556 |
T |
 |
| Q |
301 |
ttcttctc |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
15359557 |
ttcttctc |
15359564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University