View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20319_high_2 (Length: 236)

Name: NF20319_high_2
Description: NF20319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20319_high_2
NF20319_high_2
[»] chr1 (1 HSPs)
chr1 (1-199)||(13869013-13869211)


Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 13869211 - 13869013
Alignment:
1 attatcatacgcacaaaatgaatgtttcaattcaaggtttttctttaatttaaaaataaacgtgtcgtgatcaagctagaaaaaattgcccccacaattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
13869211 attatcatacgcacaaaatgaatgtttcaattcaaggtttttctttaatttaaaaataaacgtgtcgtggtcaagctagaaaaaattgcccccacaattt 13869112  T
101 tggtatgcctctagnnnnnnnnnnnnnnnnnngagagaacagtttgaaaattgcaaaatttacagattggatacaatcaaccatatcttcttttagtac 199  Q
    ||||||||||||||                  ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
13869111 tggtatgcctctagtttttatttttattttttgagagaacagtttaaaaattgcaaaatttacagattggatacaatcaaccatatcttcttttagtac 13869013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University