View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20320_high_3 (Length: 258)

Name: NF20320_high_3
Description: NF20320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20320_high_3
NF20320_high_3
[»] chr7 (1 HSPs)
chr7 (1-125)||(18821461-18821591)


Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 18821591 - 18821461
Alignment:
1 cttatattgagcctgatcctatgaacatgtactattcatcttggactatcaacattcatttgtggaggttgtgttgga------gttgagtcttcttagt 94  Q
    |||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||| ||    
18821591 cttatattgagcctcatccgatgaacatttactattcatcttggactatcaacattcatttgtggaggttgtgttggagttggagttgagtcttcttggt 18821492  T
95 ttgccatgttgcttgttgactcataatggtt 125  Q
    ||||||||||| |||||||||||||||||||    
18821491 ttgccatgttgtttgttgactcataatggtt 18821461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University