View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20320_low_4 (Length: 258)
Name: NF20320_low_4
Description: NF20320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20320_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 18821591 - 18821461
Alignment:
| Q |
1 |
cttatattgagcctgatcctatgaacatgtactattcatcttggactatcaacattcatttgtggaggttgtgttgga------gttgagtcttcttagt |
94 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
18821591 |
cttatattgagcctcatccgatgaacatttactattcatcttggactatcaacattcatttgtggaggttgtgttggagttggagttgagtcttcttggt |
18821492 |
T |
|
| Q |
95 |
ttgccatgttgcttgttgactcataatggtt |
125 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
18821491 |
ttgccatgttgtttgttgactcataatggtt |
18821461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University