View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_high_100 (Length: 216)
Name: NF20321_high_100
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_high_100 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 35034553 - 35034745
Alignment:
| Q |
17 |
cattaaaaaacaagtggaaagggatgctaaagatccaaaatatgtacttgttacatatgatggaaaacatacacatggacctgtcgttgataagaaaa-- |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
35034553 |
cattaaaaaacaagtggaaagggatgctaaagatccaaaatatgtacttgttacatatgatggaaaacatacccatggacctgtcattgataagaaaagt |
35034652 |
T |
|
| Q |
115 |
-gaccaacatactcgagaaatactaatgcagctggagtgcgtagaaatgtcagcatgccgccaccaccatcaccaccatctgcattgcctatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034653 |
cgaccaacatactcgagaaatactaatgcagctggagtgcgtagaaatgccagcatgccgccaccaccatcaccaccatctgcattgcctatg |
35034745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University