View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_high_40 (Length: 361)
Name: NF20321_high_40
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 19 - 345
Target Start/End: Original strand, 28526135 - 28526461
Alignment:
| Q |
19 |
ttagcagctatggatcaagcagtttctgatggtgttgatgtactatcactatctttaggaagtattccaaaaccattttataatgatagtattgctatag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28526135 |
ttagcagctatggatcaagcagtttctgatggtgttgatgtactatcactatctttaggaagtattccaaaaccattttataatgatagtattgctatag |
28526234 |
T |
 |
| Q |
119 |
cttcatttggagcaacgaaaaacggtgtttttgtttcttgctcagcaggcaactcaggcccttttgcatcaacggtgggaaacggcgcaccatggatcat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28526235 |
cttcatttggagcaacgaaaaacggtgtttttgtttcttgctcagcaggcaactcaggcccttttgcatcaactgtgggaaacggcgcaccatggatcat |
28526334 |
T |
 |
| Q |
219 |
gacagttgctgctagctacattgacagaacttttccaacaaaagtaaaacttggaaactcaaaaaattttgaaggcacatctttgtaccaaggaaaaaac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28526335 |
gacagttgctgctagctacattgacagaacttttccaacaaaagtaaaacttggaaactcaaaaaattttgaaggcacatctttgtaccaaggaaaaaac |
28526434 |
T |
 |
| Q |
319 |
gaaccaaaccaacaattcccacttgtt |
345 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28526435 |
gaaccaaaccaacaattcccacttgtt |
28526461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University