View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_high_51 (Length: 319)
Name: NF20321_high_51
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_high_51 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 11 - 319
Target Start/End: Complemental strand, 28526814 - 28526506
Alignment:
| Q |
11 |
gaagaatatgctgccactattggtgcaatgttaccataccttgttcctagaaaggaaattgaagctgttggttttttagtagtgttaaggtagattctaa |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28526814 |
gaagaaaatgctgccactattggtgcaatgttaccataccttgttcctagaaaggaaattgaagctgttggttttttagtagtgttaaggtagattctaa |
28526715 |
T |
|
| Q |
111 |
tagctttacctgctgaagcacctaaggaagtagctggcaaaatgtgaggatcagaaagaagctcttcgccttgatttgcagagttgagtagtatcattcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28526714 |
tagctttacctgctgaagcacctaaggaagtagctggcaaaatgtgaggatcagaaagaagctcttcgccttgatttgcagagttgagtagtatcattcc |
28526615 |
T |
|
| Q |
211 |
atatccacctgaatttttaacttccgctcctttttcggttctaccattgattcctctttcacaaacaactacttttccaaaaacaagttttttatcaagt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28526614 |
atatccacctgaatttttaacttccgctcctttttcggttctaccattgattcctctttcacaaacaactatttttccaaaaacaagttttttatcaagt |
28526515 |
T |
|
| Q |
311 |
gagtttttt |
319 |
Q |
| |
|
||||||||| |
|
|
| T |
28526514 |
gagtttttt |
28526506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University