View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_high_71 (Length: 281)
Name: NF20321_high_71
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_high_71 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 48918191 - 48917919
Alignment:
| Q |
1 |
catcaacactcactctcgctgtccctgatcctctcggctgccgtattggctccggtgccgccactctcaatgctctccactccctttctcttcattatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48918191 |
catcaacactcactctcgctgtccctgatcctctcggccgccgtattggctccggtgccgccactctcaatgctctccactccctttctcttcattatgg |
48918092 |
T |
|
| Q |
101 |
tacctctgcttccaatttgcttgcttgtaaacatgttctattgcttcatgctggtggtgattctaaaagagttccttgggctaatcctatgggaaaagtg |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48918091 |
tacctctgcttccaatgtgcttgcttgtaaacatgttctattgcttcatgctggtggtgattctaaaagagttccttgggctaatcctatggggaaagtt |
48917992 |
T |
|
| Q |
201 |
tttcttcctctccctttcttggctgatgatgaacctgatggtcctgttcctcttctttttgatcatattcttg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48917991 |
tttcttcctctccctttcttggctgatgatgaacctgatggtcctgttcctcttctttttgatcatattcttg |
48917919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University