View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_high_75 (Length: 278)
Name: NF20321_high_75
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_high_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 139 - 264
Target Start/End: Complemental strand, 42230085 - 42229959
Alignment:
| Q |
139 |
caggaacatagtcccgtgtcccaaactaggagactacaatattattaaaaa-caagaaacaaagtgtagttatatggataatgatgtttatttaaacacg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42230085 |
caggaacatagtcccgtgtcccaaactaggaaactacaatattattaaaaaacaagaaacaaagtgtagttatatggataatgatatttatttaaacacg |
42229986 |
T |
 |
| Q |
238 |
tgtgccaccaacaggaccacccttgtg |
264 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42229985 |
agtgccaccaacaggaccacccttgtg |
42229959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 10 - 111
Target Start/End: Complemental strand, 42230214 - 42230113
Alignment:
| Q |
10 |
agagaagaacagaaataagcaaattgcaaatacatgattaattgcagccattggtatacacaacgtaatgctacaaagtgacactcttcatacaacaaac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42230214 |
agagaagaacagaaataagcaaattgcaaatacatgattaattgcagccattggtatacacaatgtaatgctacaaagtgacactcttcatacaacaaac |
42230115 |
T |
 |
| Q |
110 |
cc |
111 |
Q |
| |
|
|| |
|
|
| T |
42230114 |
cc |
42230113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University