View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_high_78 (Length: 274)
Name: NF20321_high_78
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_high_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 230
Target Start/End: Original strand, 10584201 - 10584418
Alignment:
| Q |
13 |
aatatgcaaagccataaacacaataaagattatgtataattggtgagtgtagaaaaacagctcaaaattccacgtccgcactccaggaagcgaggtcacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10584201 |
aatatgcaaagccataaacacaataaagattatgtataattggtgagtgtagaaaaacagctcaaaattccacgtccgcactccaggaagcgaggtcacc |
10584300 |
T |
|
| Q |
113 |
cacatcaacaaaccagctacaaggctgataactcctgctagattggcaacaccaatatctttccattctaataactgcaaagggggaccaaattatgtaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10584301 |
cacatcaacaaaccagctacaaggctgataactcctgctagattggcaacaccaatatctttccattctaataactgcaaaggtggaccaaattatgtaa |
10584400 |
T |
|
| Q |
213 |
agatgagtaaatggttag |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10584401 |
agatgagtaaatggttag |
10584418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University