View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_high_98 (Length: 218)
Name: NF20321_high_98
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_high_98 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 17381501 - 17381698
Alignment:
| Q |
18 |
ctttggtgtgatgtgtgaagcattaggaccatccactaactcatctgttcttctgcaccacactgtagtaatacataaagagtggtcagtttcgaccgag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
17381501 |
ctttggtgtgatgtgtgaagcattaggaccatccactaactcatctgttcttctgcaccacactgtaataatacataaagagtggtcagtttctaccgag |
17381600 |
T |
|
| Q |
118 |
g---accacaatccacaatggagaagcctttgtaacagaaattttaaagttgctaattagacataccgtaaatggcccatatggcttttcttctctct |
212 |
Q |
| |
|
| |||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17381601 |
gaccaccacaatccacaacggagaagcctttgttacagaaattttaaagttgctaattaggcataccgtaaatggcccatatggcttttcttctctct |
17381698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University