View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_108 (Length: 205)
Name: NF20321_low_108
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_108 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 23972288 - 23972465
Alignment:
| Q |
18 |
aaatataccttctaatttgtattgctttactctattctatctctgattgtaaaagggtgggttagtaccatcctaatttgatttattttatggttgctat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23972288 |
aaatataccttctaatttgtattgctttactctattctatctctgattgtaaaagggtgggttagtaccatcctaatttgatttattttctggttgctat |
23972387 |
T |
|
| Q |
118 |
agtgctaggctggctgtcttcgttaaccaaactgtttgattaaaatggctagtcatgtatattattattcttctctct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
23972388 |
agtgctaggctggctgtcttcgttaaccaaactatttgattaaaatggctaggcatgtatattattattcttttctct |
23972465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 86 - 195
Target Start/End: Original strand, 46404778 - 46404886
Alignment:
| Q |
86 |
catcctaatttgatttattttatggttgctatagtgctaggctggctgtcttcgttaaccaaactgtttgattaaaatggctagtcatgtatattattat |
185 |
Q |
| |
|
||||| ||||| ||||||||| ||||||||||||||||||||||||||||||| | | || |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46404778 |
catccaaatttcatttattttctggttgctatagtgctaggctggctgtcttcaat-atttaattgtttgattaaaatggctaggcatgtatattattat |
46404876 |
T |
|
| Q |
186 |
tcttctctct |
195 |
Q |
| |
|
|||| ||||| |
|
|
| T |
46404877 |
tcttttctct |
46404886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 121 - 189
Target Start/End: Complemental strand, 33538271 - 33538203
Alignment:
| Q |
121 |
gctaggctggctgtcttcgttaaccaaactgtttgattaaaatggctagtcatgtatattattattctt |
189 |
Q |
| |
|
|||||||||| | | || ||||||||||| |||||||||| |||||||| |||||| |||||||||||| |
|
|
| T |
33538271 |
gctaggctggttttttttgttaaccaaaccgtttgattaagatggctaggcatgtagattattattctt |
33538203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University