View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20321_low_109 (Length: 202)

Name: NF20321_low_109
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20321_low_109
NF20321_low_109
[»] chr8 (1 HSPs)
chr8 (18-187)||(10935191-10935360)


Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 10935191 - 10935360
Alignment:
18 aaatctacaactaccctcttcaattttctcacattaatcgaatcttaaaccctaaaagtttcgttttttaccactttgtcttgttgggttagttcgattt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10935191 aaatctacaactaccctcttcaattttctcacattaatcgaatcttaaaccctaaaagtttcgttttttaccactttgtcttgttgggttagttcgattt 10935290  T
118 tgtgtctgtatcacctacacttctggtgaaaggtatgtttggtgtaatggtgttcgacatgtgttctgtg 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10935291 tgtgtctgtatcacctacacttctggtgaaaggtatgtttggtgtaatggtgttcgacatgtgttctgtg 10935360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University