View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_48 (Length: 338)
Name: NF20321_low_48
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 15 - 322
Target Start/End: Original strand, 30256984 - 30257291
Alignment:
| Q |
15 |
atgaaggttggagttaaacaattgaggatcactcaggattgggatgaatcaactgagaattggttaccgagagggaaatgggtgtttctcgagttgtttg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30256984 |
atgaaggttggagttaaacaattgaggatcactcaggattgggatgagtcaactgagaattggttaccgagagggaaatgggtgtttctcgagttgtttg |
30257083 |
T |
|
| Q |
115 |
aggagtgtgagagggtatcctatgttgcagtctcagtgaaacagatttggtatgatattaggatgagaaaggattttgctgaaaccattagagaatggac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30257084 |
aggagtgtgagagggtatcctatgttgcagtctcagtgaaacagatttggtatgatattaggatgagaaaggattttgctgaaaccattagagaatggac |
30257183 |
T |
|
| Q |
215 |
ttgtaatgtgaaggagttgtggagagaccttgttgttgaggtaattggtgattactataccctcacattaagtgaagttcgccctgccttaaacattcca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30257184 |
ttgtaatgtgaaggagttgtggagagaccttgttgttgaggtaattggtgattactataccctcacattaagcgaagttcgccctgccttaaacattcca |
30257283 |
T |
|
| Q |
315 |
aacaattt |
322 |
Q |
| |
|
|||||||| |
|
|
| T |
30257284 |
aacaattt |
30257291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University