View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_49 (Length: 334)
Name: NF20321_low_49
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 2312158 - 2312059
Alignment:
| Q |
18 |
gatttgaggataaaaatcaatatttcatcaaaatcatgtttgtttcaatattgacttcttgcatgtttggaattacggttgggttgacgaaatcacggtc |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2312158 |
gatttgaggatgaaaatcaatatttcatcaaaatcgtgtttgtttcaatattgacttcttgcatgtttggaattacggtaaggttgacgaaatcacggtc |
2312059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 18 - 121
Target Start/End: Original strand, 2927218 - 2927321
Alignment:
| Q |
18 |
gatttgaggataaaaatcaatatttcatcaaaatcatgtttgtttcaatattgacttcttgcatgtttggaattacggttgggttgacgaaatcacggtc |
117 |
Q |
| |
|
||||||||||| || |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
2927218 |
gatttgaggatgaagatcaatatttcatcaagatcgtgtttgtttcaatattgacttcttgcatgtttggaatttcggttaggttcacgaaatcacggta |
2927317 |
T |
|
| Q |
118 |
gcac |
121 |
Q |
| |
|
|||| |
|
|
| T |
2927318 |
gcac |
2927321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University