View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_52 (Length: 320)
Name: NF20321_low_52
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 17 - 318
Target Start/End: Original strand, 36221891 - 36222192
Alignment:
| Q |
17 |
acaagctcggactatatagtagtactagtatatgttttatcatcaaataagaatatgtgtgtacatttcacaaaatggataagcaaattggtcctcgaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36221891 |
acaagctcggactatatagtagtactagtatatgttttatcatcaaataagaatatgtgtgtacatttcataaaatggataagcaaattggtcctcgaaa |
36221990 |
T |
 |
| Q |
117 |
ttgtatttagctgtcaaaatattctctgatttttgtgaattggtaaatatacatccctaaaactgaaaagtgtcaatcaaaatagtttctctaactttta |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36221991 |
ttgtatttagctgtcaaaataatctctgatttttgtgaattggtaaatatacatccctaaaactgaaaagtgtcaatcaaaatagtttctctaactttta |
36222090 |
T |
 |
| Q |
217 |
ttattaaggactatgacatgctgaaaatatggtcctacgttgatcccacatcaatgacacaaaatcatgaactaatttgcctatgtaattcatctctctc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
36222091 |
ttattaaggactatgacatgctgaaaatatggtcctacgttgatcccacatcaatgacacaaaatcatgaactaatttgcctatgtaatttatgtctctc |
36222190 |
T |
 |
| Q |
317 |
ga |
318 |
Q |
| |
|
|| |
|
|
| T |
36222191 |
ga |
36222192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University