View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_55 (Length: 318)
Name: NF20321_low_55
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 303
Target Start/End: Original strand, 41290487 - 41290788
Alignment:
| Q |
17 |
aaaataagtagattaaatactactccatcataactcttgatttcgtctggataactttgagaataacatcaggtcgcatcaacccccttatagtacattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | | |||| ||| |||| |
|
|
| T |
41290487 |
aaaataagtagattaaatactactccatcataactcttgatttcgtctggataactttgagaataacattaggtcgcatcaatctctttatcgtaaattt |
41290586 |
T |
 |
| Q |
117 |
tgttaaacttctccagaaaa---------------aatttggaggaaatattatggtgcaacttccgtattgattttctaggaacgttcttcaactatca |
201 |
Q |
| |
|
||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41290587 |
tgttaaatttcctcagaaaaaaattacatataaaaaatttggaggaaatattatggtgcaacttccgtattgattttctagtaacgttcttcaactatca |
41290686 |
T |
 |
| Q |
202 |
acataattttacaagacatcttgcatcaatatgttaaccaattctcaaatgccaatctaaacccgctagtattaacttatccttgtctagtgtttttccc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
41290687 |
acataattttacaagacatcttgcatcaatatgttaaccaattctcaaatgccaatctaaacccgctagcattaacttatccttgtctagtttttttccc |
41290786 |
T |
 |
| Q |
302 |
at |
303 |
Q |
| |
|
|| |
|
|
| T |
41290787 |
at |
41290788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University