View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_59 (Length: 309)
Name: NF20321_low_59
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_59 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 16 - 302
Target Start/End: Original strand, 27423554 - 27423840
Alignment:
| Q |
16 |
caacatctttgtcctcaatgtattcagcaccaaagcatacaaatttggaagtgtaaatatgtccatcgtctttttcaagtggttgattttgtccaaaatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27423554 |
caacatctttgtcctcaatgtattcagcaccaaagcatacaaatttggaagtgtaaatatgtccatcgtctttttcaagtggttgattttgtccaaaatc |
27423653 |
T |
|
| Q |
116 |
attaacaaattcaggattcttaaaataagacccatgattcgaaatgcccatcggaaattctccgcatcccattgaaggactaggggtacccaaaggagtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27423654 |
attaacaaattcaggattcttaaaataagacccatgatttgaaatgcccatgggaaattctccgcatcccattgaaggactacgggtacccaaaggagtt |
27423753 |
T |
|
| Q |
216 |
gttgttatacccatccacgccacttcatcaacgtatgtcatgttcgagaataaagatgccggaaaatatccaatttccttcttctct |
302 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27423754 |
gttgttatagccatccacgccacttcatcaacgtatgtcatgttcgagaataaagatgccggaaaatatccaatttccttcttctct |
27423840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University