View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_69 (Length: 290)
Name: NF20321_low_69
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 153 - 274
Target Start/End: Complemental strand, 1877040 - 1876919
Alignment:
| Q |
153 |
aacactattaataatgatgaatctttttggttttgatatgaatttcaaaagttggaatagcataacatagtgctccatttatgtagtataagttgcaaac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1877040 |
aacactattaataatgatgaatctttttggttttgatatgaatttcaaaagttggaatagcataacatagtgctccatttatgtagtataagttgcaaac |
1876941 |
T |
|
| Q |
253 |
cttttggaaatagaattattcg |
274 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1876940 |
cttttggaaatagaattattcg |
1876919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 27 - 125
Target Start/End: Complemental strand, 1877163 - 1877065
Alignment:
| Q |
27 |
attcattcaaaccatattctatatatgaattatcatcattttttatacatattctaattcttcttcataatgtgtctatattgtgtagaaataaatggt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1877163 |
attcattcaaaccatattctatatatgaattatcatcattttttatacatattctaattcttcttcataatgtgtctatattgtgtagaaataaatggt |
1877065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University