View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_74 (Length: 279)
Name: NF20321_low_74
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_74 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 7 - 240
Target Start/End: Original strand, 40943216 - 40943449
Alignment:
| Q |
7 |
gaccatttctcaggtggctgccattgctgcacatgaccatggtgtgcaggtggagctgtcagaatctgctagggctggtgttgaggccagcagtgattgg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40943216 |
gaccatttctcaggtggctgccattgctgcacatgaccatggtgtgcaggtggagctgtcagaatctgctagggctggtgttgaggccagcagtgattgg |
40943315 |
T |
 |
| Q |
107 |
gtgatggagagtatgaacaaaggaacagacagttacggtgtcaccaccggattcggcgccacctcacaccgccgtaccaaacaaggtggtgctttgcaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40943316 |
gtgatggagagtatgaacaaaggaacagacagttacggtgtcaccaccggattcggcgccacctcacaccgccgtaccaaacaaggtggtgctttgcaga |
40943415 |
T |
 |
| Q |
207 |
aagaactcatcaggtattattcttcatttgcaca |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40943416 |
aagaactcatcaggtattattcttcatttgcaca |
40943449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 7 - 222
Target Start/End: Original strand, 40956535 - 40956750
Alignment:
| Q |
7 |
gaccatttctcaggtggctgccattgctgcacatgaccatggtgtgcaggtggagctgtcagaatctgctagggctggtgttgaggccagcagtgattgg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40956535 |
gaccatttctcaggtggctgccattgctgcacatgaccatggtgtgcaggtggagctgtcagaatctgctagggctggtgttgaggccagcagtgattgg |
40956634 |
T |
 |
| Q |
107 |
gtgatggagagtatgaacaaaggaacagacagttacggtgtcaccaccggattcggcgccacctcacaccgccgtaccaaacaaggtggtgctttgcaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40956635 |
gtgatggagagtatgaacaaaggaacagacagttacggtgtcaccaccggattcggcgccacctcacaccgccgtaccaaacaaggtggtgctttgcaga |
40956734 |
T |
 |
| Q |
207 |
aagaactcatcaggta |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40956735 |
aagaactcatcaggta |
40956750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 207
Target Start/End: Complemental strand, 28187579 - 28187380
Alignment:
| Q |
8 |
accatttctcaggtggctgccattgctgcacatgaccatggtgtgcaggtggagctgtcagaatctgctagggctggtgttgaggccagcagtgattggg |
107 |
Q |
| |
|
|||||| |||||||||||| |||||| | ||||| |||||| ||||||||| || || || || ||||| |||||| |||| || ||||| |||| |
|
|
| T |
28187579 |
accattgctcaggtggctggaattgcttcccatgatagtggtgttagggtggagctttcggagtcggcaagggccggtgttaaggcaagtagtgactggg |
28187480 |
T |
 |
| Q |
108 |
tgatggagagtatgaacaaaggaacagacagttacggtgtcaccaccggattcggcgccacctcacaccgccgtaccaaacaaggtggtgctttgcagaa |
207 |
Q |
| |
|
||||||| |||||||| ||||| || |||||||| ||||| |||||||| || || || || || ||||| | || |||||||||||||| |||||||| |
|
|
| T |
28187479 |
tgatggatagtatgaataaaggtacggacagttatggtgttaccaccggttttggtgctacttctcaccggagaactaaacaaggtggtgccttgcagaa |
28187380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University