View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_75 (Length: 279)
Name: NF20321_low_75
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_75 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 33554641 - 33554903
Alignment:
| Q |
1 |
acacaactcaaaactaaactaagaaaacaaataggttttgtgatatcattcagcaattcttatcatgactagatcattgcatcaattaattcttcggatc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33554641 |
acacaactcaaaacaaaactaagaaaacaaataggttttgtgatatcattcagcaattctcatcacgactagatcattgcatcaattaattcttcggatt |
33554740 |
T |
|
| Q |
101 |
gtttcataattgaattgagtcagtcttcaccttggaaatgtggtccaacaaatttgcagtattcatcataacaatctctttcattgtcgctcttttcttt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
33554741 |
gtttcataattgaattgagtcggtcttcaccttggaaatgtggtccaacaaatttgcagtattcatcataacaatctctttcatcgtcgctctttccttt |
33554840 |
T |
|
| Q |
201 |
catgaagtttatacgtacgatgaacatacacatacacgatggtgaacagagtagacaaaaatc |
263 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554841 |
catgaagtttagacgtacgatgaacatacacatacacgatggtgaacagagtagacaaaaatc |
33554903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University