View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_82 (Length: 270)
Name: NF20321_low_82
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_82 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 2350235 - 2349996
Alignment:
| Q |
12 |
gagatgaaaatggaaggtcggtaactgattttgagagtgatgataggaccatatttggtgtggagggttttgataaaaggttcgagttgggacgatgatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2350235 |
gagatgaaaatggaaggtcggtaactgattttgagagtgatgataggaccatatttggtgtggagggttttgataaaaggttcgagttgggacgatgatt |
2350136 |
T |
|
| Q |
112 |
ttcggagccataggatacttgtgatgatggggatatgcggtggaccnnnnnnnagggttgtggtggttttgttggtggtggtgagggaggagaagatggc |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2350135 |
ttcggagccataggatacttgtgataatggggatatgcggtggaccgggagggagggttgcggtggttttgttggtggtggtgagggaggagaagatggc |
2350036 |
T |
|
| Q |
212 |
tctgatgaggaagatgatgcagagagaaacaagtgcaatg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2350035 |
tctgatgaggaagatgatgcagagagaaacaagtgcaatg |
2349996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 14 - 247
Target Start/End: Complemental strand, 2329933 - 2329700
Alignment:
| Q |
14 |
gatgaaaatggaaggtcggtaactgattttgagagtgatgataggaccatatttggtgtggagggttttgataaaaggttcgagttgggacgatgatttt |
113 |
Q |
| |
|
|||||||||||||||||| ||| ||| || ||| ||||||||||||||| ||||| || || ||| ||| ||||||||| || |||| |||||||| |
|
|
| T |
2329933 |
gatgaaaatggaaggtcgagaaccgatattaagattgatgataggaccatgtttggcatgaagagttctgagaaaaggttcaagctgggcgaatgatttt |
2329834 |
T |
|
| Q |
114 |
cggagccataggatacttgtgatgatggggatatgcggtggaccnnnnnnnagggttgtggtggttttgttggtggtggtgagggaggagaagatggctc |
213 |
Q |
| |
|
|| |||||| |||| ||||||||||| || ||||| |||||||| ||||||| ||||||||| |||||||||| | ||| || | | |||||| |
|
|
| T |
2329833 |
cgaagccattggatgcttgtgatgattggtatatgtggtggaccaggggggagggttgcggtggttttcttggtggtggaaatggatgaaagggtggctc |
2329734 |
T |
|
| Q |
214 |
tgatgaggaagatgatgcagagagaaacaagtgc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2329733 |
tgatgaggaagatgatgcagagagaaacaagtgc |
2329700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 12 - 154
Target Start/End: Complemental strand, 2326220 - 2326078
Alignment:
| Q |
12 |
gagatgaaaatggaaggtcggtaactgattttgagagtgatgataggaccatatttggtgtggagggttttgataaaaggttcgagttgggacgatgatt |
111 |
Q |
| |
|
|||||| |||||||||||| | | | ||| || ||| ||||||||||||||| ||||| ||||| ||||||| ||||||||| |||||||| |||||| |
|
|
| T |
2326220 |
gagatgtaaatggaaggtctggagccgatattaagattgatgataggaccatgtttggcatggagagttttgagaaaaggttcaagttgggaaaatgatt |
2326121 |
T |
|
| Q |
112 |
ttcggagccataggatacttgtgatgatggggatatgcggtgg |
154 |
Q |
| |
|
||||||||||| | || ||||||||||||||||| || ||||| |
|
|
| T |
2326120 |
ttcggagccattgtatgcttgtgatgatggggatgtgtggtgg |
2326078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 14 - 119
Target Start/End: Complemental strand, 2302663 - 2302558
Alignment:
| Q |
14 |
gatgaaaatggaaggtcggtaactgattttgagagtgatgataggaccatatttggtgtggagggttttgataaaaggttcgagttgggacgatgatttt |
113 |
Q |
| |
|
|||||||||||||||||| ||| ||| | |||||||||||||||||||| ||||| ||||| ||||||| ||||||||| |||||||| |||| |||| |
|
|
| T |
2302663 |
gatgaaaatggaaggtcgagaaccgatgtggagagtgatgataggaccatgtttggcatggagagttttgagaaaaggttcaagttgggaggatggtttt |
2302564 |
T |
|
| Q |
114 |
cggagc |
119 |
Q |
| |
|
|||||| |
|
|
| T |
2302563 |
cggagc |
2302558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 14 - 145
Target Start/End: Complemental strand, 2320364 - 2320233
Alignment:
| Q |
14 |
gatgaaaatggaaggtcggtaactgattttgagagtgatgataggaccatatttggtgtggagggttttgataaaaggttcgagttgggacgatgatttt |
113 |
Q |
| |
|
|||||||||||||||||| ||| ||| | || ||||||||||||||||| ||||| ||||| ||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
2320364 |
gatgaaaatggaaggtcgagaaccgatatggacagtgatgataggaccatgtttggcatggagagttttgagaaaaggttcaagttgggagattgatttt |
2320265 |
T |
|
| Q |
114 |
cggagccataggatacttgtgatgatggggat |
145 |
Q |
| |
|
||||| || ||| |||||||||||||||| |
|
|
| T |
2320264 |
tggagcaattggaagtttgtgatgatggggat |
2320233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 15 - 145
Target Start/End: Complemental strand, 2293043 - 2292913
Alignment:
| Q |
15 |
atgaaaatggaaggtcggtaactgattttgagagtgatgataggaccatatttggtgtggagggttttgataaaaggttcgagttgggacgatgattttc |
114 |
Q |
| |
|
||||||||||||||||| ||| ||| | || ||||||||||||||||| ||||| ||||| ||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
2293043 |
atgaaaatggaaggtcgagaaccgatatggacagtgatgataggaccatgtttggcatggagagttttgagaaaaggttcaagttgggagattgattttt |
2292944 |
T |
|
| Q |
115 |
ggagccataggatacttgtgatgatggggat |
145 |
Q |
| |
|
||||| || ||| |||||||||||||||| |
|
|
| T |
2292943 |
ggagcaattggaagtttgtgatgatggggat |
2292913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 14 - 145
Target Start/End: Complemental strand, 2309375 - 2309244
Alignment:
| Q |
14 |
gatgaaaatggaaggtcggtaactgattttgagagtgatgataggaccatatttggtgtggagggttttgataaaaggttcgagttgggacgatgatttt |
113 |
Q |
| |
|
|||||||||||||||| | ||| ||| | || | ||||||||||||||| ||||| ||||| ||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
2309375 |
gatgaaaatggaaggttgagaaccgatatggacaatgatgataggaccatgtttggcatggagagttttgagaaaaggttcaagttgggagattgatttt |
2309276 |
T |
|
| Q |
114 |
cggagccataggatacttgtgatgatggggat |
145 |
Q |
| |
|
||||| || ||| |||||||||||||||| |
|
|
| T |
2309275 |
tggagcaattggaagtttgtgatgatggggat |
2309244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University