View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_88 (Length: 249)
Name: NF20321_low_88
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_88 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 27083839 - 27084060
Alignment:
| Q |
18 |
agcttctattgatgagtcacccaatttcagttattgtaagaatcacattcagcttctgagtagcaatatccatgattccattgtaaccaatttagctata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27083839 |
agcttctattgatgagtcacccaatttcagttatggtaagaatcacattcagcttctgagtagcaatatccatgattccactgtaaccaatttagctata |
27083938 |
T |
|
| Q |
118 |
tatgtacttgagtgatgaattaataataagatatgattattaatgaaagctagtagtagaaatatcttagattctctctttattgcggcggtattcttca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27083939 |
tatgtacttgagtgatgaattaataataagatatgattattaatgaaagctagtagtagaaatatcttagattctctctttattgcggcggtattcttca |
27084038 |
T |
|
| Q |
218 |
accttgtcttcagagctttcat |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27084039 |
accttgtcttcagagctttcat |
27084060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University