View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_90 (Length: 247)
Name: NF20321_low_90
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_90 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 47254838 - 47254621
Alignment:
| Q |
15 |
ataaacaacatgtcactgtctcatttcttcatctcttccatcatcatagttcacaaacccttatctctccttcaacctgagctgagatggagactcgtgc |
114 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
47254838 |
ataaacaccatgtcact--ctcatttcttcatctcttccatcatcatagttcacaaacccttatctctccttcaatctgagctgagatggagactcctgc |
47254741 |
T |
|
| Q |
115 |
ttcaaagaagagggctaacgctgaaccaattgttcttaacaataagaaacaaagggttgttttgggtgatcttcccaatttaccaaatctcaatgtttct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254740 |
ttcaaagaagagggctaacgctgaaccaattgttcttaacaataagaaacaaagggttgttttgggtgatcttcccaatttaccaaatctcaatgtttct |
47254641 |
T |
|
| Q |
215 |
ccaaaaccccaaactcagaa |
234 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
47254640 |
cccaaaccccaaactcagaa |
47254621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University