View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_91 (Length: 247)
Name: NF20321_low_91
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 231
Target Start/End: Original strand, 3629379 - 3629589
Alignment:
| Q |
21 |
aacgtgtgttgagaatgatgtttacctgnnnnnnngaatatgatagctgagtgtttttgttagtgttgtgatttataaggggaaatgctaagtaaagtgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3629379 |
aacgtgtgttgagaatgatgtttacctgaaaaaaagaatatgatagctgagtgtttttgttagtgttgtgatttataaggggaaatgctaagtaaagtgt |
3629478 |
T |
 |
| Q |
121 |
gtacctggaaaggagaaaggagaagtgaatctgaggaaggagaaagagtgaagtgatttgaggaaatttgaagtggtggtgagtttggccattgttggaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3629479 |
gtacctggaaaggagaaaggagaagtgaatctgaggaaggagaaagagtgaagtgatttgaggaaatttgaagtggtggtgagtttggccattgttggaa |
3629578 |
T |
 |
| Q |
221 |
tagattctgtg |
231 |
Q |
| |
|
|||||| |||| |
|
|
| T |
3629579 |
tagattatgtg |
3629589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 22513203 - 22513240
Alignment:
| Q |
165 |
agagtgaagtgatttgaggaaatttgaagtggtggtga |
202 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
22513203 |
agagtgaagttatttgaggaaacttgaagtggtggtga |
22513240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University