View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20321_low_98 (Length: 225)
Name: NF20321_low_98
Description: NF20321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20321_low_98 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 209
Target Start/End: Original strand, 33026028 - 33026217
Alignment:
| Q |
20 |
caggccaagatgtctcactctcttcaaccttacggattatgtccaaaagcaattcacgtggtagagtttcccattctccctttggaagaggtttaattgg |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026028 |
caggccaagatgtctcactttcttcaaccttacggattatgtccaaaagcaattcacgtggtagagtttcccattctccctttggaagaggtttaattgg |
33026127 |
T |
 |
| Q |
120 |
aagtgaatccatagcaagatgcgacactatccgatggagcaaatgctcgctctcaggaccctgctttgatattccatttttaattccctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026128 |
aagtgaatccatagcaagatgcgacactatccgatggagcaaatgctcgctctcaggaccctgctttgatattccatttttaattccctt |
33026217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 32828819 - 32828755
Alignment:
| Q |
20 |
caggccaagatgtctcactctcttcaaccttacggattatgtccaaaagcaattcacgtggtaga |
84 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||||| |
|
|
| T |
32828819 |
caggccaagatgtctcactctcttcaaccctacggattatgtccaaaagcaattcaggaggtaga |
32828755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 20 - 120
Target Start/End: Original strand, 33041114 - 33041214
Alignment:
| Q |
20 |
caggccaagatgtctcactctcttcaaccttacggattatgtccaaaagcaattcacgtggtagagtttcccattctccctttggaagaggtttaattgg |
119 |
Q |
| |
|
|||||||| |||||||||||| ||||||| | |||||||||||||||||||||||| |||||||| || |||||| ||||| | ||| ||||| |||||| |
|
|
| T |
33041114 |
caggccaaaatgtctcactcttttcaacccttcggattatgtccaaaagcaattcaggtggtagacttgcccattgtccctgttgaataggttcaattgg |
33041213 |
T |
 |
| Q |
120 |
a |
120 |
Q |
| |
|
| |
|
|
| T |
33041214 |
a |
33041214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 33019980 - 33020044
Alignment:
| Q |
20 |
caggccaagatgtctcactctcttcaaccttacggattatgtccaaaagcaattcacgtggtaga |
84 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| ||||||||||||||| |||||||| |
|
|
| T |
33019980 |
caggccaagatgtcgcactctcttcaaccctacggattatatccaaaagcaattcaggtggtaga |
33020044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University