View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20322_high_13 (Length: 289)
Name: NF20322_high_13
Description: NF20322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20322_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 30620423 - 30620658
Alignment:
| Q |
1 |
ttcatggtacaaaatctaaatggactaataaattgatcagaatcagaaaatcacaatgaacagtcatgagaatgagagattggacaatattacaatgact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30620423 |
ttcatggtacaaaatctaaatggactaataaattgatcagaatcagaaaatcacaatgaacagtcatgagaatgagagattggacaatattacaatgact |
30620522 |
T |
|
| Q |
101 |
gataaaagttaaccttaat------------aaagaaaaaggatcactagtaagtgcacgcgagagaaaaacaaacactccaaccaagagaagcttgatt |
188 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
30620523 |
gataaaagttaaccttaataaagaaagaataaaagaaaaaggatcactagtaagtgca--cgagagagaaacaaacacaccaaccaagagaagcttgatt |
30620620 |
T |
|
| Q |
189 |
agagaaaatcaacagaaaagcatccttggagttgttac |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30620621 |
agagaaaatcaacaggaaagcatccttggagttgttac |
30620658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 30618152 - 30618100
Alignment:
| Q |
218 |
agttgttacgttatgcatggcttggggaccaagccttacaggcttggttttct |
270 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30618152 |
agttgttacattatgcatggcttggggaccaagccttacaggcttggttttct |
30618100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University