View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20322_low_14 (Length: 286)
Name: NF20322_low_14
Description: NF20322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20322_low_14 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 16 - 286
Target Start/End: Original strand, 4558701 - 4558971
Alignment:
| Q |
16 |
aatattcatctctatcctgcgaaatagagaaactttgttttgatgttgaacttgaagaagtagacaactccacaagttggctattatgttttgttctgtt |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4558701 |
aatattcatctctatcctgtgaaatagaggaactttgttttgatgttgaacttgaagaagtagacaactccacaagttggctattatgttttcttctgtt |
4558800 |
T |
|
| Q |
116 |
aaccgtggaatccgatgacagactagtcggcgcagaacgcctctcaactccaaacttcttctctagtcttctactagctatggtgttttgtccattcgtc |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4558801 |
aaccgtggaatccgatgacggactagtcggcgcagaacgcctctcaactccaaacttcttctctagtcttctactagctatggtgttttgtccattcgtc |
4558900 |
T |
|
| Q |
216 |
tcatgaggagattttgatgattgcatcgattttgaagttttgaagtaattattcttatctgctgaaggaac |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4558901 |
tcatgaggagattttgatgattgcatcgattttgaagttttgaagtaattattcttatctgctgaaggaac |
4558971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University