View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20322_low_15 (Length: 266)
Name: NF20322_low_15
Description: NF20322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20322_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 3853069 - 3853307
Alignment:
| Q |
13 |
tgtttgtgattgggggtttggaagagaaagacggagggtggcaaaatgagctttcatatgtccacccaatgctttaccattgatgaatgttcttgagcaa |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3853069 |
tgtttgtggttgggggtttggaagagaaagacggagggtggcaaaatgagctttcatgtgtccacccaatgctttaccattgatgaatgttcttgagcaa |
3853168 |
T |
 |
| Q |
113 |
agcttgcatttgtacctctccatttggcattgcatagagagaaaaaggtagaaaactagaaaggctttttattgtgatagaatatgtttagaggaatttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3853169 |
agcttgcatttgtacctctccatttggcattgcatagagagaaaaaggtagaaaactagaaaggctttttattgtgatagaatatgtttagaggaatttg |
3853268 |
T |
 |
| Q |
213 |
gaaactaaaaagagtagcagctcacaagaatcccaccac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3853269 |
gaaactaaaaagagtagcagctcacaagaatcccaccac |
3853307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University