View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20324_high_12 (Length: 313)
Name: NF20324_high_12
Description: NF20324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20324_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 28 - 308
Target Start/End: Original strand, 4109228 - 4109508
Alignment:
| Q |
28 |
tgtccatgagttccaactcctcctcttccttatccatagacgttgatgaatcagcagaaacacgcatccactgtctcatatcagaacatccagttatcat |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4109228 |
tgtccatgagttccaactcctcctcttccttatccatagacgttgatgaatcagcagaaacacgcatccaccgtctcatatcagaacatccagttatcat |
4109327 |
T |
|
| Q |
128 |
cttcacacgttcctcttgctgcatgtgtcatgtcatgaagaagcttctctccaccataggtgttaatcccaccgtcatcgaattagacgacaacgagatc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109328 |
cttcacacgttcctcttgctgcatgtgtcatgtcatgaagaagcttctctccaccataggtgttaatcccaccgtcatcgaattagacgacaacgagatc |
4109427 |
T |
|
| Q |
228 |
gcctctttgtcgtctgacgatgacgatgatcttgcttccgtcctccgtaaccgctctcctgctgtcttcatctgtggtgct |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4109428 |
gcctctttgtcgtctgacgatgacgatgatcttgcttccgtcctccgtaaccgctctcctgctgtcttcattggtggtgct |
4109508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 227
Target Start/End: Complemental strand, 48154169 - 48154041
Alignment:
| Q |
102 |
ctcatatcagaacatccagttatcatcttcacacgttcctctt---gctgcatgtgtcatgtcatgaagaagcttctctccaccataggtgttaatccca |
198 |
Q |
| |
|
|||||||||||||| || || ||||||||||| || ||||| | |||||||||| |||||||||| ||| || |||| |||||| || ||| |||||| |
|
|
| T |
48154169 |
ctcatatcagaacaccctgtcatcatcttcacccgatcctcctcatgctgcatgtgccatgtcatgaggaatctcctcttcaccatcggcgttcatccca |
48154070 |
T |
|
| Q |
199 |
ccgtcatcgaattagacgacaacgagatc |
227 |
Q |
| |
|
|||| ||| |||| || |||||||||||| |
|
|
| T |
48154069 |
ccgttatccaattggatgacaacgagatc |
48154041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University