View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20324_low_1 (Length: 315)
Name: NF20324_low_1
Description: NF20324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20324_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 17 - 306
Target Start/End: Original strand, 40404803 - 40405089
Alignment:
| Q |
17 |
catgcttctatcaactctctacctttcaaagggagcaaaacgtcttgctatcattggatggatttgccttgttttcaacataagtgtatttgctgcacct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40404803 |
catgcttctatcaactctctacctttcaaagggagcaaaacgtcttgctatcattggatggatttgccttgttttcaacataagtgtatttgctgcacct |
40404902 |
T |
|
| Q |
117 |
ctcttcgtcattgtaagtattcttaatttattttttcccaattaaatgagcaaatgatgataattaaataaatattttttatgatgatttccttccatgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40404903 |
ctcttcgtcattgtaagtattcttaatttattttttcccaattaaatgagcaa---atgataattaaataaataatttttatgatgatttccttccatgc |
40404999 |
T |
|
| Q |
217 |
agagcaaagtcataaggtcaaggagcgttgaatacatgccatttttcttgtccttctttttaactatcaatgctgttatgtggttcttct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40405000 |
agagcaaagtcataaggtcaaggagcgttgaatacatgccatttttcttgtccttctttttaactatcaatgctgttatgtggttcttct |
40405089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 43 - 121
Target Start/End: Original strand, 45318010 - 45318088
Alignment:
| Q |
43 |
caaagggagcaaaacgtcttgctatcattggatggatttgccttgttttcaacataagtgtatttgctgcacctctctt |
121 |
Q |
| |
|
|||||||| | ||||||||| |||| ||||||||||| || | ||||| |||||| ||||||||||| | |||||||| |
|
|
| T |
45318010 |
caaagggatccaaacgtctttctattattggatggatatgtatggtttttaacatatgtgtatttgcttctcctctctt |
45318088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University