View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20325_low_10 (Length: 214)
Name: NF20325_low_10
Description: NF20325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20325_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 48493912 - 48493728
Alignment:
| Q |
18 |
ttcttatgacatgatgacttggcaattattccttttgcaggttctatggatccagcatccaatagtttgattcaaatgagaaagaatcatggaataattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48493912 |
ttcttatgacatgatgacttggcaattattccttttgcaggttctatggatccagcatccaatagtttgattcaaatgagaaagaatcatggaataattg |
48493813 |
T |
|
| Q |
118 |
gtataatagggtggggcttaatcctaccagtaggtgcaattgttgctaggtacttcaaacataaggaacccctttggttctatct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48493812 |
gtataatagggtggggcttaatcctaccagtaggtgcaattgttgctaggtacttcaaacataaggaacccctttggttctatct |
48493728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University