View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20325_low_5 (Length: 292)
Name: NF20325_low_5
Description: NF20325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20325_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 152 - 282
Target Start/End: Original strand, 50632529 - 50632659
Alignment:
| Q |
152 |
attattgttgtcacatgtaagttgtttgttgctttttgtaaccatgggctttgagtcgacatagtgattttaaggttaaaccccctttcatgtcacggat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50632529 |
attattgttgtcacatgtaagttgtttgttgctttttgtaaccatgggctttgagtcgacatagtgattttaaggttaaaccccctttcatgtcacggat |
50632628 |
T |
|
| Q |
252 |
agcttgtttattgttgaccacacaggttctg |
282 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
50632629 |
agcttgtttattgttgaccacacagtttctg |
50632659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 50632361 - 50632421
Alignment:
| Q |
17 |
atgaatgaatgaccaatgttttcacttggctgctatttaaggtagtttggtcggtgagcta |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50632361 |
atgaatgaatgaccaatgttttcacttggctgctatttaaggtagtttggtcggtgagcta |
50632421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University