View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20325_low_7 (Length: 273)
Name: NF20325_low_7
Description: NF20325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20325_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 35047174 - 35046914
Alignment:
| Q |
1 |
aaattcaaatggaatgatgatgtcgttcatatatcggtagtcgatcaaggcaaatggtaagtgtctaagacccaagtgatttcagttttcacattcaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35047174 |
aaattcaaatggaatgatgatgtcgttcatatatcggtagtcgatcaaggcaaatggtaagtgtctaagacccaagtgatttcagttttcacattcaatt |
35047075 |
T |
|
| Q |
101 |
tccatatccaatttttgaatatcacttatcttatatgcgtgcttgttttcaatgactaggtggtttgcgaagcgtttcttacatcccgacatagttgctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35047074 |
tccatatccaatttttgaatatcacttatcttatatgtgtgcttgttttcaatgactaggtggtttgcgaagcgtttcttacatcccgacatagttgctg |
35046975 |
T |
|
| Q |
201 |
agtatgattatattttcctttgggatgaggacctaggagtagaaaacttccaccctgagaa |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35046974 |
agtatgattatattttcctttgggatgaggacctaggagtagaaaacttccaccctgagaa |
35046914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 157 - 234
Target Start/End: Original strand, 132119 - 132196
Alignment:
| Q |
157 |
taggtggtttgcgaagcgtttcttacatcccgacatagttgctgagtatgattatattttcctttgggatgaggacct |
234 |
Q |
| |
|
|||||||||||| || || || || ||||| |||||||||||||| || ||||||| || || |||||||||||||| |
|
|
| T |
132119 |
taggtggtttgcaaaacgatttttgcatccagacatagttgctgactacaattatatatttctctgggatgaggacct |
132196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University