View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20325_low_8 (Length: 272)
Name: NF20325_low_8
Description: NF20325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20325_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 256
Target Start/End: Original strand, 31639455 - 31639703
Alignment:
| Q |
8 |
gagatgaaggtcttaccggttcaatctctggtccgatttttaggacattgatctcatcacgtgttgaaatgagtgtgtcgttagcatttcttagtaaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31639455 |
gagatgaaggtcttaccggttcaatctctggtccgatttttaggacattgatctcatcacatgttgaaatgagtgtgtcgttagcatttcttagtaaaca |
31639554 |
T |
 |
| Q |
108 |
aaacaaggagtctgtaaagaagctgaaaatatcaataatatttgtgttatttgatggataatccaggaacaacaaggaggtaaaatagggatagcactag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31639555 |
aaacaaggagtctgtaaagaagctgaaaatatcaataatatttgtgtcatttgatggataatccaggaaaaacaaggaggtaaaatagggatagcactag |
31639654 |
T |
 |
| Q |
208 |
atgctgtttggtatgaacctataactgaacttgatgaagacaaagaagc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31639655 |
atgctgtttggtatgaacctataactgaacttgatgaagacaaagaagc |
31639703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University