View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20326_high_19 (Length: 205)
Name: NF20326_high_19
Description: NF20326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20326_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 53957367 - 53957557
Alignment:
| Q |
1 |
tcgtgtccggtgtctgtgtccgtattcgttcttcatagtctcaaaataattgtattaaataaaagtatgagttgaaataataaaaattactacatgttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53957367 |
tcgtgtccggtgtctgtgtccgtattcgtgcttcatagtctcaaaataattgtattaaataaaagtatgagttgaaataataaaaattactacatgttgc |
53957466 |
T |
|
| Q |
101 |
agctgcagcagtgagagttaggatatcactagcacttgtgccattcatggctgagccaataacacttctaagatcctctttcttagctccc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53957467 |
agctgcagcagtgagagttaggatatcactagcacttgtgccattcatggctgagccaataacacttctaagatcctctttcttagctccc |
53957557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 7171483 - 7171446
Alignment:
| Q |
1 |
tcgtgtccggtgtctgtgtccgtattcgttcttcatag |
38 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
7171483 |
tcgtgtccggtgtctgtgtccgtatccgtgcttcatag |
7171446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University