View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20326_high_19 (Length: 205)

Name: NF20326_high_19
Description: NF20326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20326_high_19
NF20326_high_19
[»] chr4 (1 HSPs)
chr4 (1-191)||(53957367-53957557)
[»] chr3 (1 HSPs)
chr3 (1-38)||(7171446-7171483)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 53957367 - 53957557
Alignment:
1 tcgtgtccggtgtctgtgtccgtattcgttcttcatagtctcaaaataattgtattaaataaaagtatgagttgaaataataaaaattactacatgttgc 100  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53957367 tcgtgtccggtgtctgtgtccgtattcgtgcttcatagtctcaaaataattgtattaaataaaagtatgagttgaaataataaaaattactacatgttgc 53957466  T
101 agctgcagcagtgagagttaggatatcactagcacttgtgccattcatggctgagccaataacacttctaagatcctctttcttagctccc 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53957467 agctgcagcagtgagagttaggatatcactagcacttgtgccattcatggctgagccaataacacttctaagatcctctttcttagctccc 53957557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 7171483 - 7171446
Alignment:
1 tcgtgtccggtgtctgtgtccgtattcgttcttcatag 38  Q
    ||||||||||||||||||||||||| ||| ||||||||    
7171483 tcgtgtccggtgtctgtgtccgtatccgtgcttcatag 7171446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University