View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20326_low_20 (Length: 222)
Name: NF20326_low_20
Description: NF20326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20326_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 46314864 - 46315054
Alignment:
| Q |
13 |
gagatgaaacaacctgctggtcgtcgtcttttgaaggaaagtgttgatggagaagaggatgttttaggtcatggtggtgattttgagcttcctgagtggg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46314864 |
gagatgaaacaacctgctggtcgtcgtcttttgaaggaaagtgttgatggagaagaggatgttttaggtcatggtggtgattttgagcttcctgagtggg |
46314963 |
T |
 |
| Q |
113 |
ttgatgaccgtgccggtgttaggaaacttcttaataaaatgactggaaggaaacttcaggctcatgttgttgttgctaaggatggaagtgg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46314964 |
ttgatgaccgtgccggtgttaggaaacttcttaataaaatgactggaaggaaacttcaggctcatgttgttgttgctaaggatggaagtgg |
46315054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University