View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20327_high_23 (Length: 325)
Name: NF20327_high_23
Description: NF20327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20327_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 19 - 175
Target Start/End: Original strand, 5526029 - 5526187
Alignment:
| Q |
19 |
acttcgtgtttattttagcttggccccattctctactttgtagagcaaacattaaaaaccatgtcccctcgtaccc--tttggtggtcttgtaatctgaa |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
5526029 |
acttcgtgtttattttagcctggccccattctctactttgtagagcaaacattaaaaaccatgtcccctcgtacccccttgggtggtcttgtaatctgaa |
5526128 |
T |
 |
| Q |
117 |
agttaagttttgattgccttggcttattgtccaaggacttatgagtgacataaagtagt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5526129 |
agttaagttttgattgccttggcttattgtccaaggacttatgagtgacataaagtagt |
5526187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 172 - 311
Target Start/End: Original strand, 5526879 - 5527018
Alignment:
| Q |
172 |
tagtgattttagtgcatgttcactagatttgctaaaataatgaagatcatagtgatttcagcaaatccaccatcaataatctggaaaatgtaaatattta |
271 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5526879 |
tagtaattttagtgcatgttcactagatttgctaaaataacgaagatcatagtgatttcagcaaatccaccatcaataatctggaaaatgtaaatattta |
5526978 |
T |
 |
| Q |
272 |
taattcattatatttcgttgtttcacattgattatctata |
311 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
5526979 |
taattcattagatttcgttgtttcacattcattatctata |
5527018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University